Protocol 4: RNA interference (RNAi)

Download as printable PDF

4.1: Clonación de genes

4.2: Preparación de alimento

4.3: Alimento ARNi con bacteria

4.4: Alimento ARNi con ARNds

4.5: Alimentaciones de ARNi

Tabla

 



El ARNi revela la función del gen debido a la capacidad del protocolo para destruir el ARNm del gen de interés que da como resultado un fenotipo. El aspecto más desafiante de este experimento es la clonación de genes y, para las clases de nivel inferior, la preparación de alimentos.

 

4.1: Clonación de genes

MATERIALES REQUERIDOS
TRIzol®
Tubos de plástico (15, 1.5 and 0.2 ml) y pestels
Cloroformo, isopropanol y etanol
Purificador de agua Milli-Q
Espectrofotómetro NanoDrop 1000
Kit SuperScript III (Oligo (dT)20 primer, dNTPs Mix, 5x tampón de primera cadena, DTT, inhibidor de RNasa y SuperScript III retro transcriptasa)
Tubos de plástico (0.2 ml)
Termociclador
Cebadores F and R (Tabla 6)
Phusion ADN polimerasa junto con 5x tampones de alta fidelidad, dNTPs mix, MgCl2
Agarosa y 1x tampón TAE
Cámara de electroforesis
Colorante de carga y marcador de ADN de 1 kb
Transiluminador UV
Kit de purificación QIAquick PCR o QIAquick Gel Extraction Kit (cuchilla y termobloque)
Plásmido PR-T4P
Enzima de restricción Smal y10x NEB tampón #2
T4 polimerasa, su tampón y BSA

 

 

 

 

 

 

 

 

 

 

 

En cuanto al protocolo WISH, los primeros pasos del protocolo ARNi en planarias son: buscar secuencias específicas de especies de ARNm que correspondan a los genes de interés y diseñar cebadores F y R (Tabla 6) como se describe en la Sección 3.1, producir el ADNc y clonar el gen de interés como se describe en la Sección 3.2, transformar las bacterias y secuenciar la inserción como se describe en la Sección 3.3

volver arriba


 

4.2: Preparación de alimento

MATERIALES REQUERIDOS
Hielo y contenedores
Cuchilla y licuadora
Molino de alimentos o tamiz
Cucharas
Plato pequeño de Petri (35 x 10 mm, 5 ml) o envoltura de plástico

La pasta de hígado de ternera fresca se prepara cortándolo y homogeneizándolo en una licuadora. El hígado debe mantenerse en hielo durante todo el proceso para preservarlo. Los pasos para la preparación del alimento de ARNi son:

  1. Retira la cápsula (capa de tejido exterior transparente) del hígado (descapsulación) cortando la superficie del hígado con una cuchilla y moviendo el dedo entre la cápsula y el hígado.
  2. Corta el hígado en trozos grandes y elimina de estos todo el tejido conectivo y los vasos sanguíneos agarrando un extremo y raspando la superficie del hígado con una cuchilla.
  3. Transfiere el hígado a una licuadora o procesador de alimentos y mezcle hasta que el hígado se vea cremoso y homogéneo.
  4. Filtra el hígado mezclado como paso final para eliminar los restos de la vasculatura. O bien, un molino de alimentos o un tamiz colocado encima de un recipiente en hielo se puede utilizar como un filtro. El uso de un tamiz requerirá una cuchara de madera para forzar la pasta de hígado a través del tamiz.
  5. Transfiere el hígado a una placa de Petri pequeña (35 x 10 mm, 5 ml) o haz una porción pequeña de alimento envuelto en una envoltura transparente de plástico.
  6. Almacena a -20°C o -80°C, respectivamente, durante 3 o 6 meses.

volver arriba


 

4.3: Alimento de ARNi con bacterias

MATERIALES REQUERIDOS
Opción 2: stock de glicerol de Escherichia coli HT115 transformada
Caldo 2x YT medio-Kan (50 μg / ml) Tet (12.5 μg / ml)
Incubadora a 37°C y agitador
Tubo de plástico (1.5 and 50 ml)
Espectrofotómetro
Isopropyl β-D-1-thiogalactopyranoside (IPTG)
Pasta de hígado de ternera (Sección 4.2) y colorante alimenticio rojo
Centrífuga y su adaptador para tubos de 50 ml
Instant Ocean® sal marina o 1x agua Montjuïc
Toalla de papel, agua Milli-Q y hielo

El primer método de ARNi implica inducir bacterias transformadas con el constructo para transcribir el inserto en el plásmido para generar ARN de doble cadena (ARNds) y luego mezclar estas bacterias con la pasta de hígado. Cuando las planarias comen el alimento, las células planarias toman el ARNds y activan la ruta que degrada el ARNm con una secuencia complementaria a una de sus cadenas. Este método funciona para Girardia sp. y D. dorotocephala, pero P. morgani y P. gracilis no consumen alimentos mezclados con bacterias y es necesario el protocolo informado en la Sección 4.4.

Gracias al fuerte fenotipo demostrado por el ARNi de los dos genes seleccionados (β-catenina-1 y ODF2), 3 alimentaciones de ARNi son suficientes. Siguiendo este protocolo, se pueden preparar 250 ul de alimento de ARNi (3-4 alimentaciones para 30 a 50 gusanos) a partir de 50 ml de cultivo de bacterias transformadas.

 

Manteniendo el constructo (3 μl) en hielo, se le añadieron 48 μl de cepa competente de Escherichia coli HT115. La mezcla se incubó durante 10 minutos en hielo, y luego se realizó un choque térmico durante 35 segundos a 42°C, después de lo cual el tubo se llevó de vuelta al hielo. Después de 5 minutos, la E. coli transformada se colocó a temperatura ambiente y se añadió 1 ml de Caldo de Luria (LB) sin antibióticos. Las células se colocaron en un agitador a 250 rpm durante 1 hora a 37°C para su recuperación y, finalmente, todo el cultivo de bacterias se movió a 4 ml de un caldo de cultivo de 2x YT medium-Kan (50 μg / ml) -Tet (12,5 μg / ml).

Nota: El stock de glicerol es una mezcla compuesta por 50% de bacterias en caldo de cultivo y 50% de glicerol que puede almacenarse a -80°C durante mucho tiempo y usarse como iniciador para un nuevo cultivo de bacterias, cuando sea necesario. Si se dispone de una reserva de glicerol de bacterias HT115 ya transformadas con el constructo de interés se pueden recoger pocas bacterias de aquí y agregarse a 5 ml de 2x YT medium-Kan (50 μg / ml) -Tet (12,5 μg / ml )

  1. Incuba el cultivo de bacterias durante la noche (ON) a 37°C agitando a 250 rpm.
  2. Precalienta 45 ml del medio 2x YT fresco para cada cultivo ON a 37°C.
  3. Agrega 50 μg/ml de Kan y 12.5 μg/ml de Tet al medio 2x YT caliente y coloca 45 ml de este en un tubo de centrífuga de 50 ml.
  4. Transfiere 1:50 del cultivo ON a 45 ml del caldo 2x YT medium-Kan (50 μg / ml) -Tet (12.5 μg/ml).
  5. Incuba el cultivo a 37°C agitando a 250 rpm.
  6. Después de 1 hora, comprueba el valor OD600 con el espectrofotómetro.
  7. Cuando el OD600 mida 0.6-1, agrega 1 mM de isopropil β-D-1-tiogalactopiranósido (IPTG) para inducir la síntesis de ARNds en la bacteria.
  8. Incuba el cultivo de bacterias durante 2 horas a 37°C agitando a 250 rpm.
  9. Si un cultivo termina con la inducción antes que el otro, colócalo en hielo hasta que todo esté listo.
  10. Descongela la pasta de hígado.
  11. Gira el cultivo de bacterias a 3000 xg durante 10 minutos.
  12. Mezcla: pasta de hígado, 10% de agua de planaria y 1:50 de colorante rojo.
  13. Elimina los medios bacterianos y coloca los tubos boca abajo sobre una toalla de papel.
  14. Agrega 50 ml de agua Milli-Q y disuelve el pellet, para eliminar las sales residuales que pueden ser poco apetecibles para las planarias.
  15. Gira el cultivo de bacterias a 3000 xg durante 10 minutos.
  16. Elimina el agua y coloca los tubos boca abajo sobre una toalla de papel.
  17. Agrega 150 μl de mezcla de hígado (pasta de hígado/agua/colorante rojo) en cada tubo de 50 ml.

Nota: corta el extremo de la punta para pipetear el hígado.

  1. Combina bien la mezcla de hígado con la bacteria.
  2. Divide en partes proporcionales los alimentos en tubos de 1.5 ml y guárdalos a -20 ° C o -80 ° C.

Nota: usualmente se requiere 1 ul de alimento por gusano.

 

volver arriba


 

4.4: Alimento de ARNi con ARNds

MATERIALES REQUERIDOS
Phusion ADN polimerasa, junto con tampón GC, cebador T7, dNTPs mix y MgCl2
Termociclador y tubo de plástico (0.2 and 1.5 ml)
Agarosa y tampón TAE 1x
Cámara de electroforesis
Colorante de carga y 1 escalera de ADN de 1kb
Transiluminador UV
Kit de purificación de QIAquick PCR
T7 ARN polimerasa junto con su tampón de transcripción, NTPs mix (ATP, CTP, GTP y UTP), inhibidor de RNAsas
Agua Milli-Q
Termobloque
RQ1 DNasa
Amonio acetato 5M
Etanol 70% y 100%
Espectrofotómetro NanoDrop 1000
Pasta de hígado de ternera (Sección 4.2) y colorante alimenticio rojo

El segundo método para inducir ARNi es mezclar la pasta de hígado con ARNds purificado generado in vitro a partir del constructo de interés. Cuando las planarias comen el alimento, las células planarias toman el ARNds y activan la ruta que degrada el ARNm con una secuencia complementaria a una de sus cadenas. Este método es mejor para P. morgani y P. gracilis, que no comen alimentos mezclados con bacterias.

Una vez que el gen de interés se clonó con éxito, el inserto se amplificó por reacción de PCR, usando el constructo como molde, el cebador T7 (5'-TAATACGACTCACTATAGGG-3 '), la enzima Phusion ADN polimerasa y su tampón GC (New England Biolabs), siguiendo las instrucciones del fabricante. Para obtener la cantidad requerida de secuencia de inserción amplificada, se preparan 240 μl (4 reacciones/60 μl en total cada una) de reacción PCR con 100 ng de plantilla en cada reacción. Se utilizó el siguiente programa de PCR de toma de contacto:

  •   1 ciclo: 30 segundos a 98°C
  •   40 ciclos: 10 segundos a 98°C, 20 segundos a 56°C, 90 segundos a 72°C
  •   1 ciclo: 10 minutos a 72°C.

Una pequeña alícuota del ADN amplificado (1-2 μl) se ejecutará en gel de agarosa al 1% en 1x TAE para verificar si la reacción funcionó correctamente. El ADN contenido en la alícuota residual (237-238 μl) se purifica con el kit de purificación QIAquick PCR

 

El ADN purificado fue la plantilla para la Reacción de Transcripción para producir el ARNds. La reacción se realizó mezclando 2.5-3 μg del fragmento de ADN amplificado y purificado con el tampón de transcripción, la mezcla de ribonucleótidos (ATP, CTP, GTP y UTP), el ARN polimerasa T7 (Invitrogen) y el inhibidor de la RNasa (Promega) en agua Milli-Q hasta un volumen final de 200 μl. Incubar la reacción a 37 ° C.

El ARNds se trató con 5 μl de RQ1 DNasa (Promega). La reacción se incubó durante 20 minutos a temperatura ambiente.

 

El ARNds se precipitó bajo el siguiente protocolo:

  1. Agrega 1 volumen de Amonio acetato 5M y 2.5 volúmenes de Etanol al 100%.
  2. Incuba durante 30 minutos -20ºC.
  3. Gira durante 15 minutos a 4°C a velocidad máxima.
  4. Retira el sobrenadante.
  5. Lava con Etanol al 70%.
  6. Gira durante 15 minutos a 4°C a velocidad máxima.
  7. Retira el sobrenadante y seca el sedimento durante 5 minutos a temperatura ambiente.
  8. Vuelve a suspender el sedimento en 75 μl de agua Milli-Q.

Una pequeña alícuota del ARNds sintetizado (2 μl) se ejecutará en gel de agarosa al 0.8% en TAE para comprobar si la reacción funcionó correctamente. Podría suceder que la banda no esté bien definida o no tenga exactamente el tamaño esperado debido a la diferente propiedad de migración del ARNds en comparación con el ADN y el ARN. La concentración del ARNds debe ser de aproximadamente 3-4 μg/μl después de la salida del espectrofotómetro NanoDrop 1000. El ARNds se almacena a -80°C.

El día de la alimentación, el ARNds y una alícuota de pasta de hígado se descongelan. El ARNds se mezcla con el colorante alimentario rojo y luego se añaden a la pasta de hígado y se mezclan con la proporción de hígado:colorante alimentario rojo:ARNds igual a 30:3:5

volver arriba


 

4.5: Alimentaciones de ARNi

MATERIALES REQUERIDOS
Placas de Petri
Instant Ocean® Sal Marina y 1x agua de Montjuï
Opción 1: Pasta de hígado de ternera mezclada con bacterias (Sección 4.2 y 4.3)
Opción 2: Pasta de hígado de ternera (Sección 4.2), colorante alimentario rojo y ARNd (Sección 4.4)
Botella flexible o botella estándar
Contenedor de basura
Toallas de papel o limpiador de laboratorio KimWipes™
Opcional para la amputación: etanol, cuchilla

Los genes sugeridos para el protocolo ARNi tienen un fenotipo realmente pronunciado que aparece después de 3 alimentaciones. Para cada experimento, se usaron 3-5 de control y 3-5 gusanos ARNi, todos de 4-7 mm de largo y que han pasado hambre durante al menos 7-10 días.

  1. Mueve los gusanos en las placas de Petri (1 plato para el control y 1 plato para cada tratamiento) con agua fresca de planaria.
  2. Al día siguiente, coloca los platos sobre una superficie que no sea perturbada.
  3. Deja a los gusanos 30-60 minutos en la oscuridad.
  4. Descongela la comida 30 minutos antes de que los gusanos estén listos para la alimentación. La comida es hígado mezclado con la bacteria para Girardia sp. y D. dorotocephala o pasta de hígado y ARNds para P. morgani y P. gracilis.

Nota: La alimentación para Girardia sp. y D. dorotocephala está lista para usarse; la alimentación para P. morgani y P. gracilis tiene que prepararse fresca, mezclando la pasta de hígado, el colorante rojo y el ARNds en la proporción 30:3:5.

  1. Corta el extremo de la punta de pipeta de 200 μl y úsalo para agregar 1-3 μl de alimento para cada gusano en la placa de Petri.
  2. Deja que los gusanos coman durante 1-2 horas.
  3. Retira la comida no consumida y reemplaza el agua con agua fresca de planaria.
  4. Coloca los gusanos en el lugar donde normalmente se mantienen.
  5. El día después de la alimentación, deja a los gusanos sin tocar.
  6. El segundo día después de la alimentación, mueve los gusanos a una nueva placa de Petri y cambia el agua como se describe en la Sección 1.2.
  7. El tercer día después de la primera alimentación, le proporcionarás la segunda alimentación a los gusanos.
  8. Continúa con el mismo programa hasta la tercera alimentación.  
  9. Tres días después de la última alimentación, corta los gusanos en 3 partes (cabeza, tronco y fragmento de cola) siguiendo el protocolo descrito en la Sección 2.1.
  10. Revisa diariamente los gusanos para observar el fenotipo emergente en el fragmento de regeneración.

Nota: el fenotipo para ambos genes β-catenina-1 y odf-2 también aparece en los gusanos que no son amputados, pero lleva más tiempo y la eficiencia es menor. Si el investigador está interesado en descubrir la función del gen de interés en la homeostasis de los gusanos, no debería cortar los gusanos e iniciar la observación desde el día posterior a la última alimentación. Si el investigador quiere descubrir la función del gen de interés en la regeneración de los gusanos, debe cortarlos y comparar el proceso de regeneración del fragmento entre el control y los gusanos interferidos.

volver arriba


 

Tabla 6: Cebador para el protocolo de ARNi

Especie de planaria Nombre del gen Secuencia de Cebador F Secuencia de Cebador R

Longitud de secuencia

Girardia sp. beta-catenin TAGTATGTCAAGGCACAACG GTATGGCCGATGTTAGTCTG 2749
D. dorotocephala beta-catenin TTGGAAAGTCACAGTCACAG GTGTCTAACATGCACACGTC 2669
P. morgani beta-catenin GCCTATCGAACATAAGCATC GTAGTCAATCGAAGGTCGAG 3049
P. morgani odf2 TCAATTGCTCTAGCTGCTTC AAAGGATCCAAGTCCACATT 1003
P. gracilis beta-catenin TGGATTCAGAAGACCAGAAC CGATCATGTGTGTTTGCTAC 2613

 

volver arriba


Created by

Powered By

Admin Log In

Education - This is a contributing Drupal Theme
Design by WeebPal.